https://www.genoglobe.com/kribb/ 2026-04-04T10:27:37+00:00 https://www.genoglobe.com/kribb/ https://www.genoglobe.com/kribb/_media/wiki/logo.png text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/1.reseq?rev=1615954153&do=diff ######################### # 2017 C&K Workshop # # Resequencing Code # # 2017. 11 # ######################### ########Resequencing ########### cd /home/workshop/1.WGS_practice/Genome_analysis ### FASTQC fastqc --nogroup paired_end_sep1.fq paired_end_sep2.fq ### TRIMMOMATIC java -jar /home/Program/Trimmomatic-0.33/trimmomatic-0.33.jar \ PE paired_end_sep1.fq paired_end_sep2.fq paired_end_1P.fastq.gz paired_end_1U.fastq.gz \ paired_end_2P.fastq.gz paired_end_2U.fastq.gz \… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/2.rnaseq?rev=1615954153&do=diff ##### installing packages example (will not do in workshop) tr() setRepositories() install.packages("psych") library(psych) tr() m <- matrix(1:16,ncol=4) tr(m) ##################################### ################# # Basic plots # ################# x11(width = 6, height = 6) #code to open up a window in linux counts <- matrix( rnorm(200,mean=0,sd=1),20,10 ) #make a normal count boxplot( counts[,1],counts[,3],counts[,5],counts[,7],counts[,9],counts[,10] , col=c("black","blue","green","red… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/3.between_species?rev=1615954153&do=diff #Install Bioedit #Install notepad++ #Install Python2.7.9 ##################### # Branch-based test # ##################### cd 0.Data\branch-based ..\..\1.prank\bin\prank.exe -d=GDPD4_cds.fa -o=GDPD4_MSA_cds -codon -F # double click "reorder_ID.py" ..\..\2.Gblocks_0.91b\Gblocks.exe GDPD4_MSA_cds_reordered.fa -t=c # open ctl files and check paths of seq, output, tree ..\..\3.paml4.9e\bin\codeml.exe GDPD4_H0.ctl > GDPD4_H0.report ..\..\3.paml4.9e\bin\codeml.exe GDPD4_H1.ctl > GDPD4_H1.report #che… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/16s_rrna_sequencing_data_types?rev=1615954153&do=diff 16S rRNA sequencing data types 여기에서는 주로 QIIME 1.9.1을 이용한 16S rRNA 서열 분석 방법에 대하여 다루고 있다. 시퀀싱 데이터 타입에 대해서는 QIIME 2에서 더욱 명확하게 정의하고 있어서 첫 섹션에 소개하였다. 인터넷에 돌아다니는 QIIME 1용 실습 자료는 주로 454 혹은 일루미나의 multiplexed single-ended fastq file(barcode reads가 별도 파일로 주어지는)에 적합하게 만들어진 것 같다. text/html 2022-03-24T01:18:33+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/2022_microbial_genome_analysis_course_plan?rev=1648084713&do=diff 2022년 미생물 유전체 분석 강좌 계획안 문서 최종 수정일: --- Haeyoung Jeong 2022/03/15 19:09 이 문서는 수강생 여러분이 아니라 저를 위해 만드는 것입니다. 설명이 친절하지 않아도 양해를 부탁드립니다^^ text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/all_about_illumina_sequence_assembly_for_microbial_genomes?rev=1615954153&do=diff All about Illumina sequence assembly for microbial genomes 본 문서에서 소개한 사례에서는 gzip 압축이 된 Illumina paired fastq file(file_1.fastq.gz & file_2.fastq.gz)을 시작점으로 한다. 여기에서 다루는 방법은 어디까지나 나의 경험에 의한 제안일 뿐, 반드시 이를 지켜야 하는 것은 아니다. 생소한 이름의 shell script는 내가 직접 작성하거나, 인터넷에 공유된 것을 수정한 것이다. 이 페이지는 아직 완성되지 않은 상태이다.… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/anaconda_installation?rev=1615954153&do=diff Anaconda installation on shared storage (NFS) Conda, Anaconda, Bioconda의 기본 개념에 대해서는 블로그에 쓴 글(링크)를 참조하기 바란다. 그동안 CentOS 6.x을 꾸준히 사용해 오다가 2018년 3월 내가 사용하는 몇 대의 리눅스 서버 중 하나(microbe)에 CentOS 7.x를 처음으로 설치하면서 응용 프로그램 관리에 뭔가 획기적인 변화를 가져오기를 꿈꾸었다. 구체적인 방법으로서 Conda/Anaconda/Bioconda를 사용한 프로그램 설치 및 환경 관리를 하는 것으로 마음이 기울었다. 그리고 되도록이면 모든 서버에 마운트된 공용 공간을 프로그램 설치 공간으로 적극 활용하기로 하였다. 설치를 위한 공간은… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/antismash?rev=1615954153&do=diff Bioconda 환경에서 antiSMASH 설치하고 활용하기 <https://docs.antismash.secondarymetabolites.org/install/> # conda create -n antismash antismash # source activate antismash (antismash) # download-antismash-databases Downloading large file Pfam-A.hmm.gz. Please be patient... Downloading Pfam-A.hmm.gz finished successfully. Creating checksum of Pfam-A.hmm.gz Extraction of Pfam-A.hmm.gz finished successfully. Downloading large file clusterblast_20170105_v8_31.tar.xz. Please be patient... Downloading clusterblas… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/application_of_pacbio_long_reads_sequencing_technology?rev=1615954153&do=diff Application of PacBio long-reads sequencing technology (software) 이 페이지는 Oxford Nanopore Technologies(ONT)의 sequencing 응용도 포함할 수 있도록 개편되어야 한다. 즉, long read, single molecule 기반의 염기서열 해독을 전부 망라하도록 한다. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/atcc_6051a?rev=1615954153&do=diff Bacillus subtilis ATCC 6051a * Title: Complete genome sequence of Bacillus subtilis strain ATCC 6051a, a potential host for high-level secretion of industrial enzymes * Genome Annonc. 2015 May 21; 3(3) e00532-15 PubMed Full text link * A complete list of variants among strains 168, ATCC 6051, and ATCC 6051a: text/html 2025-01-15T03:49:37+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/bioinfo?rev=1736912977&do=diff Bioinformatics Resources 일러두기 이 사이트는 인터넷을 둘러보시는 여러분들에게 미생물 유전체정보학 또는 생명정보학 지식을 체계적으로 전달하기 위해 만든 것이 결코 아닙니다. 그저 제 기억을 보조하기 위한 수단으로 글을 쓰기 시작하였고, 혹여 제 위키사이트 방문자에게 도움이 되었다면 영광이겠습니다. Genome sequencing 기술이 끝없이 발달하고 있으므로 여기에 작성된 글 중 수 년이 지난 것은 이미 현실에 맞지 않을 것입니다.… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/blast2go_pro?rev=1615954153&do=diff Blast2GO Pro 사용법 라이센스 정보 * BlastGO PRO subscription, single user license * 기간: 2015년 3월 27일-2017년 3월 31일(3년) * Subscription key: * 설치 위치: tube server /opt/Blast2GO_3.x/Blast2GO * 작업 위치: /home/hyjeong/b2gWorkspace text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/bracken_for_species_abundance_esimation?rev=1615954153&do=diff Bracken: estimating species abundance in metagenomic data Kraken은 매우 빠르고 능률적인 read classifier이다. 즉 read 하나에 대해서 taxonomic label을 부여하는 것이 고유 기능이다. 그러나 metagenomics 연구에서 가장 근본적인 질문 중 하나는 샘플 안에 존재하는 미생물이 각 종별로 얼마나 존재하는가, 즉 abundance를 추정하는 것이다. 이를 위해서는 각 종의 genome size 등 고려할 것들이 많다. 미국 존스홉킨스 대학에서는 Kraken의 성능을 그대로 이용하되 베이즈 추론을 사용하여 species abundance를 추정하는 새로운 프로그램인 Bracken(Baysian Reestimation of Abundance after Classification with KrakEN)을 2017년 1월에 발표하였기에 이를 소개하고자 한다.… text/html 2022-07-25T05:21:32+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/building_myubuntu_distro?rev=1658726492&do=diff myUbuntu(a.k.a. KRIBBuntu) distro 제작 및 재설치 과정 Conda base environment에서 되도록 많은 응용프로그램이 무난하게 돌아갈 수 있도록 조건을 잡느라 시간이 많이 걸렸다. 우분투 및 프로그램 설치, distro 파일 제작과 재설치를 통한 테스트를 족히 수십 차례는 진행한 것 같다. 2022년 3월 22일 드디어 myUbuntu distro 최초 버전이 나왔고 5월 31일 KRIBBuntu-focal_2205를 제작하였다. 두 디스트로는 전부 Ubuntu 20.04 LTS를 이용한 것이다.… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/candida_aaseri_2017?rev=1615954153&do=diff Candida aaseri SH-14 Basic information Candida aaseri (syn. Candida butyri) SH-14 a lipase producing yeast that has industrial potential. This strain can be used as as a biocatalyst in the pharmaceutical, fine chemicals, detergent, cosmetics, food, environmental industries and biodiesel production. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/cmg-biotools%EC%9D%98_%ED%99%9C%EC%9A%A9?rev=1615954153&do=diff CMG-biotools 기능 실습 개요 VirtualBox 환경에서 CMG-biotools 가상머신을 켠 후 바탕화면에서 마우스 오른쪽 버튼을 클릭하여('Open Terminal Here') 터미널창을 띄운 뒤 다음에 소개하는 명령어를 입력하여 실습을 진행한다. CMG-biotools의 명령어(스크립트)들은 /usr/biotools에 있으니 필요하다면 다른 리눅스 시스템에 복사하여 사용해도 된다. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/cnk_workshop_2017?rev=1615954153&do=diff C&K Genomics 2017 Bioinformatics Analysis Workshop 실습용 파일 설명 을 다운로드하여 압축을 풀면 다음의 세 디렉토리가 생성된다. 1번과 2번 디렉토리는 리눅스 가상머신에서 사용한 쉘 스크립트가 들어있다. 3번 과정은 Windows에서 실행해야 하며 필요한 데이터와 프로그램이 들어있으므로 이를 그대로 복사해야 한다. 본 자료파일은 C&K Genomics의 허락을 받아서 공개하는 것이다. text/html 2021-08-10T03:51:05+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/cog_assignment?rev=1628567465&do=diff NCBI COG software를 이용한 query protein의 COG assignment 방법 COG(clusters of orthologous groups)의 개요는 블로그에 포스팅한 COG 2014년 개정판 음미하기를 참조하라. 개정판에 대한 논문은 2015년 초에 Nucl. Acids Res.에 게재되었다. 2020년 업데이트에 대한 글은 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/cogclass2018.pl?rev=1615954153&do=diff COGclass2018.pl written by Haeyoung Jeong. #!/usr/bin/perl # $ARGV[0]: GenQuery.COG.csv.bestHit; $fun = '/data/Utilities/DB/COG/COG2014/fun2003-2014.tab'; $name = '/data/Utilities/DB/COG/COG2014/cognames2003-2014.tab'; open FUN, $fun; while (<FUN>) { chomp; next if /^#/; my @temp = split /\t/, $_; $code2fun{$temp[0]} = $temp[1]; push @oneLetter, $temp[0]; } close FUN, open NAME, $name; while (<NAME>) { chomp; next if /^#/; my @temp = split /\t/, $_; if (le… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/custom_kraken_db_test?rev=1615954153&do=diff Custom kraken DB test Kraken에서 database란 아주 구체적으로 말하자면 디렉토리 명칭이다. DB 작성을 위해 모은 염기서열 fasta file 모음은 library라 부른다.Kraken DB가 수록한 내용은 library에서 추출한 모든 k-mer에 대해서 taxonomy 정보를 연결해 놓은 것이라고 생각하면 간단하다. 만약 어떤 k-mer가 여러 genome에 공통적으로 존재한다면 어떤 taxonomy 정보를 연결할 것인가? 이 경우에는 lowest common ancestor(LCA)를 연결한다. 보다 상세한 내용은… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/custom_scripts_for_16s_rrna_sequence_analysis?rev=1615954153&do=diff Custom scripts for 16S rRNA sequence analysis merge_paired_fastq.sh #!/bin/bash # # modified from 'Merge_Reads_Script.sh' available from: # https://github.com/edamame-course/Amplicon_Analysis/blob/master/resources/Merged_Reads_Script.sh # out=merged_dir if [ ! -d merged_reads ]; then echo Creating ${out} directory... mkdir ${out} fi for f in *F_sub.* do if [ ! -e ${f} ]; then echo Can\'t find 'F_sub' reads! echo You have to set fwd/rev read indicators in this scr… text/html 2023-06-29T03:13:44+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/custom_scripts?rev=1688008424&do=diff my_rename1.pl #!/usr/bin/perl # open ALL, $ARGV[0] or die "Can't open file $ARGV[0]!"; while (<ALL>) { chomp; next unless /^(GCF|GCA)/; my @data = split /\t/, $_; $data[8] =~ s/strain=//; # infraspefic_name my $strain = $data[8]; $data[7] =~ s/ $strain$//; # remove redundant strain name my $name = $data[7] . ' ' . $data[8]; $name .= $data[15] if $name =~ /^\S+ \S+ $/; # add asm_name if required $name =~ s/:/-/g; $name =~ s/\s+/_/g; $name =~ s/;.*$//; … text/html 2023-02-15T01:43:19+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/data_visualization?rev=1676425399&do=diff Data visualization 데이터 시각화의 목적은 화려한 그림으로 독자나 청중을 현혹하거나 기술을 과시하고자 함이 아니라, 어떤 메시지를 효과적으로 전달하기 위함이다. R을 활용함으로서 데이터의 시각화가 가능하다. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/day1_exercise1?rev=1615954153&do=diff #1 install.packages("lars") #2 library(lars) search() ls(2) #3 help.search("string") #4 example("rnorm") #5 80/(1.8)^2 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/day1_exercise2?rev=1615954153&do=diff #1 ch = c("0","21","12","16") #2 y = as.numeric(ch) y = sort(y) y #3 y2 = seq(0,24,by=8) y2 #4 sum((y < y2) == (y<=y2)) #5 x = seq(from=1,by=2,length=30) x #6 rep(c(T,F),times=5) #7 sum(x[x>10 & x<20]) #8 xmat = matrix(x,6,5,byrow=T) #9 z = list( sumr=apply(xmat,1,sum), meanc=apply(xmat,2,mean), varc=apply(xmat,2,var)) z text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/day1_exercise3?rev=1615954153&do=diff #1 dat=read.csv(file='Ex_data.csv',stringsAsFactors=F) #2 head(dat) #3 dim(dat) #4 write.table(dat[,1],file='gene_name.txt',quote=F,sep='') #5 x=dat[,2:10] head(x) write.table(x,file='sub_data.txt',quote = F,sep = '\t') #6 y=dat[nchar(dat[,1])>7,] dim(y) write.table(y,file='sub_data2.csv',sep=',') #7 sum(is.na(dat)) #8 which(is.na(dat)) #9 which(is.na(dat),arr.ind = T) #10 index=which(is.na(dat),T) dat[index]=10 sum(is.na(dat)) dat[index] text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/day1_exercise4?rev=1615954153&do=diff x = runif(10) #1 if(sum(x)>5) { cat('sum(x) is greater than 5.\n') } else if(sum(x)<5) { cat('sum(x) is less than 5.\n') } else cat('sum(x) is equal to 5.\n') #2 y = ifelse(x<0.5,x,x-0.5) #3 i=3 switch(i,x+y,x-y,x*y) text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/day1_practice2?rev=1615954153&do=diff real <- 3.5 as.integer(real) intg <- 3 is.integer(intg) intg2 <- 1:5 is.integer(intg2) intg3 <- 1.5:3 is.integer(intg3) real <- 3 is.double(real) is.numeric(1:3) is.numeric(3.5) ch <- c("red","blue", "yellow") ch2 <- c('a','b',"c") test <- c(TRUE,FALSE,TRUE) is.logical(test) test2 <- c(T,F,T) as.numeric(test2) as.logical(c(0,1,2,-1)) x <- "char" mode(x) x <- 5 is.character(x) is.numeric(x) is.double(x) x <- "abc" as.double(x) x <- 1 as.character(x) as.character(123) vec <- c(1,3,4,2,5) # … text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/day1_practice3?rev=1615954153&do=diff # " " – 공백 (default: sep=" ") myname <- "Jason Bourne" paste("My name is", myname, sep=" ") # file name file_id = 1533 paste("Dataset_",file_id, ".txt",sep="") # vector arguments paste(LETTERS[1:5],1:5) # vector 인수들을 원소별로 결합 후 collapse 정의 문자로 구분 # (default) collapse = NULL paste("A","B",collapse='/') paste(c("A","B"),collapse='/') paste(c("A","B"),1:2,collapse='/') paste(c("A","B"),1:2,sep='?', collapse='/') # paste(vector1, ..., sep=‘’,collapse= NULL) paste(c("A","B"),1:2,sep='',collapse='/')… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/day1_practice4?rev=1615954153&do=diff setwd('/BiO/example/dataset') x <- 1:5 y <- -2:2 if(any(x<0)) print(x) # 하나의 논리값을 위해 any 사용 if(any(y<0)) print(abs(y)) if(y<0) print(y) # 벡터논리값은 error if(any(y<0)) { print(abs(y)) cat("\n y contains negative values") } # print(x)는 x의 내용을 보여 주는 함수. if(pi>3) cat("\n expr(T)") else cat("\n expr(F)") if(pi<3) cat("\n expr(T)") else cat("\n expr(F)") x <- 1:3 if(length(x)==5) { if(sum(x)== 15) cat("\n Vector x length=",length(x),", sum = ",sum(x)) } else { cat("\n Vector x length !=",l… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/day2_practice1?rev=1615954153&do=diff .Platform setwd('/BiO/example/dataset') raw_dat = read.csv(file="Ex_data.csv", header=T,stringsAsFactors=F) head(raw_dat[,1:20]) # 열의수가 많아 1:20의 열만 선택 dim(raw_dat) # gl ( group의 수, group의 크기 ) # 1,2,group의 수 해당하는 Factor 형 벡터 생성 gr_ind = gl(2, 221) # 1 x 221, 2 x 221 = c(1,...,1,2,...,2) dat_mat <- t(as.matrix(raw_dat[,-1])) dim(dat_mat) rownames(dat_mat) <- paste0("S",1:nrow(dat_mat)) colnames(dat_mat) <- raw_dat[,1] head(dat_mat[,1:20]) indx <- which(is.na(dat_mat),T) indx… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/day2_practice2?rev=1615954153&do=diff # Uniform a= 3 b= 5 dunif(4.25,min=a,max=b) punif(3.5, a,b,lower.tail=F) # 1-F(x) 계산, F(x): CDF qunif(0.75,min=a,max=b,lower.tail=T) # CDF이용 분위수를 계산 x = runif(1000,a,b) hist(x,breaks=15,F) # Hypergeometry m = 3; n = 2; k = 3 dhyper(2, m, n, k, log = F) # HG(m+n, m, k) phyper(3, m, n, k, lower.tail = TRUE,log.p=T) phyper(3, m, n, k, lower.tail = TRUE,log.p=F) phyper(2, m, n, k, lower.tail = TRUE) qhyper(0.7, m, n, k, lower.tail = T) x = rhyper(100, m, n, k) tb_x = table(x) tb_x plot(tb_x) # Bin… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/day2_practice3?rev=1615954153&do=diff anscombe apply(anscombe,2,mean) apply(anscombe,2,sd) cor(anscombe) attach(anscombe) cal_corr = c(cor(x1,y1),cor(x2,y2),cor(x3,y3),cor(x4,y4)) names(cal_corr) = paste(paste("x",1:4,sep=''),paste("y",1:4,sep=''),sep=' vs. ') cal_corr res = list() res[[1]] = lm(y1~x1) res[[2]] = lm(y2~x2) res[[3]] = lm(y3~x3) res[[4]] = lm(y4~x4) summ = matrix(0,4,4) cname = paste(paste("x",1:4,sep=''),paste("y",1:4,sep=''),sep=' vs. ') colnames(summ) = cname rownames(summ) = c("estimated beta0", "estmated beta1"… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/de_novo_assembly?rev=1615954153&do=diff De novo assembly 1. Velvet (optional) Interleaved file의 준비 $ /usr/local/Bio/velvet_1.2.10/contrib/shuffleSequences_fasta/shuffleSequences_fastq.pl BL21-20x_1.fastq BL21-20x_2.fastq BL21-paired.fastq * 최근에는 -separate 옵션이 추가되어서 2개의 paired file을 그대로 공급해도 됨 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/detection_of_recombination_in_bacterial_genomes?rev=1615954153&do=diff Detection of recombination in bacterial genomes 일단 Zakour의 다음 자료를 정독하라. Xabier Didelot는 microevolution 과정에서 recombination이 중요함을 인식하고 이를 검출하는 ClonalFrame이라는 프로그램을 개발하였다( text/html 2021-05-18T09:27:54+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/doing_data_science?rev=1621330074&do=diff Doing data science 인공 지능과 머신 러닝, 딥 러닝의 차이점을 알아보자 Richard Sprague, Deep learning and the microbiome 나이브베이즈를 이용한 스팸 필터링 <https://heartbeat.fritz.ai/spam-filtering-using-bag-of-words-1c5484ff07f1> dataset for bag of words text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/dokuwiki_tips?rev=1615954153&do=diff DokuWiki tips Tips and tricks for Dokuwiki 현명한 URL 작성법(.htaccess 수정 필요) - URL rewriting 그림 파일 이외의 것을 업로드하려면 conf/mime.conf 파일을 수정해야 한다. MIME configuration 시간대 변경하기 text/html 2024-11-27T23:53:22+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/downloading_genomes_from_ncbi_ftp_site?rev=1732751602&do=diff NCBI FTP 사이트에서 유전체 정보 파일 다운로드하기 Entrez API를 사용하려면 NCBI Insights에서 제공하는 문서인 How to Download Bacterial Genomes Using the Entrez API를 참조하기 바란다. Access and Download Sequence Data and Metadata Using NCBI Datasets - Goodbye Assembly and Genome, hello NCBI Datasets!(2024년 8월 13일) --- Haeyoung Jeong 2024/11/28 08:51 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/escherichia_coli_rr1?rev=1615954153&do=diff Unveiling the hybrid genome structure of Escherichia coli RR1 (HB101 RecA+) text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/extracting_mapped_reads?rev=1615954153&do=diff Extracting mapped reads Reference sequence에 매핑된 read를 뽑아내는 방법은 몇 가지가 존재한다. CLC Genomics Workbench에서도 다음 사이트를 참조하여 실행하면 된다. CLC Exporting Mapped Reads 그러나 이 방법이 특정 reference sequence(혹은 특정 region)에 mapping된 read만을 꺼낼 수 있는지, 혹은 reference set 전체에 대해서도 적용 가능한지는 자세히 확인하지 않았다. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/fastq_%ED%8C%8C%EC%9D%BC%EC%9D%98_qc?rev=1615954153&do=diff Fastq 파일의 QC Java runtime 설치 여부의 확인(리눅스) $ java -version java version "1.6.0_38" OpenJDK Runtime Environment (IcedTea6 1.13.10) (6b38-1.13.10-0ubuntu0.12.04.1) OpenJDK 64-Bit Server VM (build 23.25-b01, mixed mode) $ 기본 사용법 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/fillaccession.pl?rev=1615954153&do=diff fillAccession.pl #!/usr/bin/perl # while (<>) { chomp; if (/^LOCUS\s+([^\s]+)\s+/) { $acc = $1; $ver = $1 . '.1'; print $_, "\n"; } elsif (/^ACCESSION/) { print "ACCESSION $acc\n"; } elsif (/^VERSION/) { print "VERSION $ver\n"; } else { print $_, "\n"; } } text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/findbestfromcogs.pl?rev=1615954153&do=diff findBestCOGs.pl written by Haeyoung Jeong #!/usr/bin/perl # while (<>) { chomp; my @data = split /,/, $_; push @{$perQuery{$data[0]}}, $_; $query{$data[0]} = ''; } foreach (sort keys %query) { if (scalar @{$perQuery{$_}} == 1) { print $perQuery{$_}->[0], ',none', "\n" if $perQuery{$_}->[0] =~ /,\-1$/; print $perQuery{$_}->[0], ',sinlge', "\n" if $perQuery{$_}->[0] =~ /COG\d{4}$/; } else { # multiple COGs assigned per a single query my @sorted = … text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/four_bacillus_strains_2016?rev=1615954153&do=diff Four Bacillus strains (2016) * Title: Draft genome sequences of four plant probiotic Bacillus strains. Genome Announcements (2016) 4 e00358-16. antiSMASH 3.0 results Genome sequences and annotations are also available from the NCBI web site. * Bacillus endophyticus KCTC 13922T [Zipped GenBank file (PGAP)] [Zipped antiSMASH results] * text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/gc_skew.pl?rev=1615954153&do=diff #!/usr/bin/perl use Bio::SeqIO; $window = 5000; # 10 kb $shift = 5000; # 2 kb $seqIn = Bio::SeqIO->new(-file => $ARGV[0], -format => 'fasta'); $seqObj = $seqIn->next_seq(); $seqStr = $seqObj->seq(); $length = $seqObj->length(); @whole_seq = split //, $seqStr; $cum_GC_skew = 0; for ($i = 1; $i <= $length; $i += $shift) { $end = $i + $shift - 1; $end = $length if $end > $length; $frag = $seqObj->trunc($i, $end)->seq(); $G = ($frag =~ s/g/G/ig); $C = ($frag =~ s/c/C/ig); … text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/genome_annotation?rev=1615954153&do=diff Prokaryotic genome annotation RAST server NCBI PGAP (Prokaryotic Genome Annotation Pipeline) DOE-JGI IMG Prokka 위에서 소개한 방법들은 전부 genome sequence를 외부에 보내어서 주석화를 실시하는 것이다. 만약 소중한 나의 유전체 정보가 어디론가 새어나갈것 같은 불안감이 있다면, 리눅스 서버에 Prokka를 설치하여 직접 주석화를 하면 된다. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/genome_record_submission_and_update?rev=1615954153&do=diff Submission Update Updating information on GenBank draft genome record (NCBI) You can download the annotation .tbl file from Entrez if you look at the 'Send' option and choose 'Complete Record' then 'File' as Destination and then Format 'Feature table'. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/genome_sequence-based_species_identification?rev=1615954153&do=diff Genome sequence-based species identification 외부 자료 * [정해영의 블로그] EzBioCloud 제대로 사용하기 * [정해영의 블로그] 쉽게 쓴 원핵생물(prokaryote)의 종 동정 이야기 * [정해영의 블로그] ANI 매트릭스로 덴드로그램 그리기 * [정해영의 블로그] Strain, clone and species * [정해영의 블로그] 유전체 서열을 이용한 세균의 종(species) 동정 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/gnu_parallel?rev=1615954153&do=diff GNU Parallel 활용 가이드 컴퓨터 클러스터에 대한 전문적인 지식 없이도 간편하게 병렬 작업을 하도록 도와주는 유틸리티가 있으니 그것이 바로 GNU Parallel이다. 작게는 단일 호스트에서 다중 코어에 능률적으로 job을 배분하는 것으로부터 시작하여 SSH로 접속되는 다중 원격 호스트를 통하여 병렬 작업을 하는 것까지 그 활용의 폭은 매우 넓다. 이것에 익숙해지면 앞으로는 for loop나 xargs를 쓸 일이 없을 것이다.… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/google_chrome_installation_in_centos_6.x?rev=1615954153&do=diff CentOS 6.x에 구글 크롬 설치하기 참조 사이트: <https://hunit.tistory.com/264> 크롬 저장소를 새로 만든다. # vi /etc/yum.repos.d/google-chrome.repo 다음 내용을 추가한다. [google-chrome] name=google-chrome baseurl=http://dl.google.com/chrome/rpm/stable/x86_64 enabled=1 gpgcheck=1 gpgkey=https://dl-ssl.google.com/linux/linux_signing_key.pub text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/histo2plot.sh?rev=1615954153&do=diff #!/bin/sh # by Haeyoung Jeong FILENAME=$(basename "$1") #sample.hist or sample.pe.histo #BASE=${FILENAME/.*} BASE=${FILENAME/.hist*} echo "File base: $BASE" echo "set term png" > ${BASE}.gp echo "set output \"${BASE}.png\"" >> ${BASE}.gp #echo "set datafile separator \",\"" >> ${BASE}.gp echo "set logscale x" >> ${BASE}.gp echo "set logscale y" >> ${BASE}.gp echo "set grid" >> ${BASE}.gp echo "set xlabel \"kmer frequency\"" >> ${BASE}.gp echo "set ylabel \"number of distinct kmer\"" >> ${BASE}… text/html 2023-10-11T06:25:52+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/kribbuntu-focal_2205?rev=1697005552&do=diff KRIBBuntu-focal_2205 distro 제작 및 재설치 과정 개요 KRIBBuntu란 Linux용 Linux 하위시스템(Windows Subsystem for Linux, WSL)에서 실행되는 우분투 기반의 배포(distro)입니다. 우분투 20.04LTS(Focal Fossa)를 근간으로 만들어졌기에 KRIBBuntu-focal_YYMM이라는 별칭으로도 부릅니다. KRIBBunt는 Windows 컴퓨터에 가볍게 설치하여 미생물 유전체 데이터를 다루기 위한 목적으로 만들어졌습니다. 대부분의 응용프로그램은 conda 환경을 통하여 설치하였으며, 만약 여러분에게 리눅스 컴퓨터가 있다면 본 문서의 응용프로그램 설치 과정을 참조하여 직접 분석 환경을 만들 수 있을 것입니다. v2207에서는 관리자 권한('sudo' 명령어)를 쓰지 않고도 모든 응용프로그램을 설치해 보았으며, Windows 11 환경에서 테스트를 완료하였습니다. 아무쪼록 이 리소스가 여러분의 연구에 도움이 조금… text/html 2023-02-15T08:04:31+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/manipulation_of_ani_matrix_data_file_using_r?rev=1676448271&do=diff R을 이용하여 ANI matrix 자료 다루기 제목은 ANI matrix(행렬)라고 하였으나 실제로는 dataframe 자료를 다루는 기술에 관하여 작성한 글이다. 실습용 파일 을 다운로드하여 압축을 해제한다. RefSeq genome 51개를 text/html 2022-03-30T00:07:20+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/manipulation_of_fastq_files?rev=1648598840&do=diff Manipulation of FASTQ files 본 위키 사이트 내의 여러 페이지에서 간단한 fastq 파일 조작법을 필요한 곳에 소개해 두었다. 이 페이지에서는 이들을 종합함과 동시에 새로운 기법도 소개함을 목적으로 한다. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/markers.fasta?rev=1615954153&do=diff >ecpE ECP production pilus chaperone 336904:337614 reverse atgttcaggcgacgtggcgtaacattaactaaggccctgctgacagcggtctgtatgctg gcggcacctttgacacaggcgatttcggtcggcaatctgactttttcactgccgtccgag actgactttgtcagcaaacgtgtagtgaataacaacaaaagcgcgcggatataccgtatt gccatcagtgctatcgatagcccgggcagcagtgaattacgcacccgaccggtggatggt gaactgcttttcgccccccgccagctggcgttgcaggctggtgagagcgagtattttaaa ttttactatcatgggccacaggataaccgcgagcgctactaccgggtctcatttcgcgag gtccccactcgtaacctgacaaaacgcagccctaccggcggtgaggttagcacggagccg gtggtggtgatgga… text/html 2021-11-18T01:29:34+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/massive_pcr_primer_design?rev=1637198974&do=diff Massive PCR primer design 다수의 염기서열에 대한 batch primer design * PrimerView 다중서열정렬(multiple sequence alignment)를 대상으로 하는 primer design * EasyPrimer * PrimerDesign-M text/html 2022-07-08T03:44:03+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/metagenomic_data_assembly_pipeline?rev=1657251843&do=diff Metagenomic data assembly pipeline metaWRAP MetaWRAP—a flexible pipeline for genome-resolved metagenomic data analysis 논문 GitHub 설치하기 * 설치 환경: ryzen-5950x server(32 threads, 128G memory) * 설치 방법 설명 문서 * 설치 시작일: 2022년 7월 76일 text/html 2022-07-07T01:30:10+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/metagenomics?rev=1657157410&do=diff Haeyoung's metagenomics resource Useful papers, websites, and videos * An introduction to the analysis of shotgun metagenomic data (Front. Plant Sci. (2014) * Shotgun metagenomics, from sampling to analysis. Nature Biotechnol. (2017) * Metagenomic Workshop in Uppsala * 2017 Metagenomics workshop at UC Santa Cruz * Metagenomics wiki * mothur and QIIME Despite their differences in philosophy, most of the differences in mothur and QIIME are cosmetic. * Aligning 16S sequences to refe… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/metainformation_for_genomes?rev=1615954153&do=diff 미생물 유전체 정보 등록을 위한 메타정보 작성 양식 유전체 서열 정보를 활용한 논문을 출판하려면 NCBI 등의 공공 DB에 염기서열 정보가 공개된 상태어야 한다. 이에 못지않게 유전체 시퀀싱에 사용한 연구 대상 생명체 자체의 정보(분류학상 명칭, 분리원, 특성 등)와 시퀀싱을 통한 연구의 목적도 서열 정보의 활용을 위하여 대단히 중요하다. NCBI에서는 BioProject와 BioSample 섹션에 이러한 메타 정보를 제출하여 등록을 거치도록 웹 인터페이스 환경을 갖추고 있다.… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/metamos_installation?rev=1615954153&do=diff MetAMOS의 설치와 활용 개요 * [논문] MetAMOS: a modular and open source metagenomic assembly and analysis pipeline. Genome Biology 2013 14:R2 * [공식 문서] <http://metamos.readthedocs.io/en/v1.5rc3/> * [iMetAMOS 논문] Automated ensemble assembly and validation of microbial genomes. BMC Bioinformatics 2014 15:126 - iMetAMOS는 MetAMOS 환경에서 돌아가는 workflow의 일종이다. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/metamos_test_2017?rev=1615954153&do=diff MetAMOS test 2017 많은 어려움을 뚫고서 2016년 초여름에 MetAMOS를 설치하여 어느 상태로는 돌아가게 만드는데 성공하였다. 그러나 인쇄한 매뉴얼이 너덜너덜해지도록 줄을 치고 메모해가면서 정독하고 테스트를 하였지만 아직 완벽한 상태는 아니다. 만 1년이 되기 전에 사용법을 완전히 익히고 어느 리눅스 서버에든 쉽게 재설치를 할 수 있도록 다시 한 번 종합적인 테스트를 실시한다.… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/metaphyler_example?rev=1615954153&do=diff MetaPhyler .family.tab file example @family @% abundance @depth of coverage @number of reads Chroococcales{order} 95.41 37.9 4243 Comamonadaceae 1.27 0.5 134 Rhizobiaceae 0.81 0.32 47 Burkholderiales{order} 0.69 0.27 76 Caulobacteraceae 0.34 0.13 24 Alphaproteobacteria{class} 0.27 0.1 25 Proteobacteria{phylum} 0.25 0.1 24 Sphingomonadaceae 0.21 0.08 15 Betaproteobacteria{class} 0.18 0.07 21 Sphingomo… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/mg-globos?rev=1615954153&do=diff mg-GlobOS 소개의 글 mg-GlobOS는 2019년 11월 11일 개최된 포스트게놈다부처유전체사업 재직자 재교육 단기과정('미생물 유전체의 해독과 분석')에서 사용한 실습 환경을 사용자 여러분의 컴퓨터에서 재현할 수 있도록 만든 가상 시스템입니다. mg는 microbial genome, GlobOS는 (Geno)Globe + text/html 2021-10-05T03:42:21+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/microbial_forensics?rev=1633405341&do=diff Micronial Forensics 이 위키 페이지는 Petter Lindgren 등의 2019년 논문 A likelihood ratio-based approach for improved source attribution in microbiological forensic investigations에서 다룬 시나리오 1의 분석 과정을 학습하기 위하여 작성한 것입니다. 저자가 제공하는 원본 데이터 및 소스 프로그램(Perl & R)은 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/modifygffforclc_gw.pl?rev=1615954153&do=diff #!/usr/bin/perl # # This script assumes that the input GFF file has only CDS/tRNA/rRNA/tmRNA # features. It adds gene features to all of them, and also adds "mRNA" features # to each CDSs. # # while (<>) { chomp; print $_, "\n" if /^#/; last if /^##FASTA/ || /^>/; my @data = split /\t/, $_; if ($data[2] =~ /(CDS|rRNA|tRNA|tmRNA)/) { # skip e.g. repeat_region $type = $1; $data[2] = 'gene'; print join "\t", @data; print "\n"; # add gene feature … text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/my_brew_list?rev=1615954153&do=diff My "brew list" $ brew list bedtools circos expat gdbm gperftools libidn m4 openssl prank webp binutils cmake fasttree gettext idba libmpc mafft parallel python xz bison cpanminus flex git isl libpng makedepend patchelf raxml zlib boost curl fontconfig glib jdk libtiff mcl pcre readline bwa cytoscape freetype glibc jpeg libunwind mpfr phylip snp-sites bzip2 docbook … text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/my_ncbi_submission?rev=1615954153&do=diff My NCBI Submission 유의할 사항 * 등록 때에는 description이나 alias에 그저 생물학적 시료의 이름을 나열하는 것보다 좀 더 신경써서 기록하는 것이 나중에 도움이 된다. 웹 브라우저에서 가장 먼저 보이는 것은 title이 아니고 alias이므로 여기에 정보를 함축적으로 담는 것이 바람직하다. 특히 SRA의 Experiment level에서는 시퀀싱 플랫폼이 드러나게 alias를 설정하는 것도 좋을 것이다. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/my_pacbio_sequencing_experiences_at_kribb?rev=1615954153&do=diff My PacBio sequencing experiences at KRIBB Year Folder Samples Collaborator(s) Notes 2013 (DNA Link) 38_ArM29B Chlorella sp. ArM0029B 정원중 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/myillu_01.trimpe.sh?rev=1615954153&do=diff Script <myIllu_trimPE.sh> #!/bin/bash # # takes two paired files, run trimmomatic (PE mode), and makes one interleaved file # Trimmomatic v0.32 manual: # http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/TrimmomaticManual_V0.32.pdf # # Latest version of ngopt (a5_miseq): 20150522 TRIMMOMATIC=/usr/local/apps/a5_miseq_linux_20140604/bin/trimmomatic.jar ADAPTER=/usr/local/apps/a5_miseq_linux_20140604/adapter.fasta INTERLEAVE=/usr/local/apps/khmer/khmerEnv/bin/interleave-reads.py TH… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/myillu_02_jellyfish.sh?rev=1615954153&do=diff Script <myIllu_02_jellyfish.sh> #!/bin/sh export LD_LIBRARY_PATH=/usr/local/apps/jellyfish-2.2.3/lib KMER=21 THREADS=20 BASE=${1%%.*} echo "File name base: $BASE" echo "Running jellyfish..." jellyfish count -s 1G -m ${KMER} -t ${THREADS} -o kmer -C $1 jellyfish dump -c -t kmer > ${BASE}.kmer${KMER}.txt echo "Preparing histogram..." awk '{print $2}' ${BASE}.kmer${KMER}.txt | sort -n | uniq -c | awk '{print $2 "," $1}' > ${BASE}.jf.hist text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/myillu_04_plotkmer.sh?rev=1615954153&do=diff Script <<myIllu_plotKmer.sh>> #!/bin/sh FILENAME=$(basename "$1") #sample.hist or sample.pe.fq.hist #BASE=${FILENAME/.*} BASE=${FILENAME/.hist} echo "File base: $BASE" echo "set term png" > ${BASE}.gp echo "set output \"${BASE}.png\"" >> ${BASE}.gp echo "set datafile separator \",\"" >> ${BASE}.gp echo "set logscale x" >> ${BASE}.gp echo "set logscale y" >> ${BASE}.gp echo "set grid" >> ${BASE}.gp echo "set xlabel \"kmer frequency\"" >> ${BASE}.gp echo "set ylabel \"number of distinct kmer\"" … text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/myillu_06_sga.sh?rev=1615954153&do=diff myIllu_06_sga.sh #!/bin/bash -x BASE=$(basename "$1") # delete any leading path BASE=${BASE%%.*} rm temp_1.fq temp_2.fq # # Parameters # # Program paths SGA_BIN=/usr/local/bin/sga BWA_BIN=/usr/local/apps/bwa-0.7.12/bwa SAMTOOLS_BIN=/usr/local/apps/samtools-1.2/samtools BAM2DE_BIN=/usr/local/apps/sga/src/bin/sga-bam2de.pl ASTAT_BIN=/usr/local/apps/sga/src/bin/sga-astat.py DISTANCE_EST=/usr/local/apps/abyss-1.9.0/DistanceEst/DistanceEst SEQTK=/usr/local/apps/seqtk/seqtk # The number of threa… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/mypro_%ED%99%9C%EC%9A%A9%ED%95%98%EA%B8%B0?rev=1615954153&do=diff MyPro 활용하기 MyPro(a seamless pipeline for automated prokaryotic genome assembly and annotation, PubMed)는 여러가지면에서 매우 독특하다. 설치와 사용이 쉬운 생명정보 분석용 도구는 누구나 꿈꾸고 있는 바이다. 파라미터 설정과 같은 골치아픈 것들은 생각하지 않고 그저 마우스 클릭 한번에 원하는 분석을 다 해준다면 얼마나 좋을까? 이를 구현하는 방법에도 다양한 형태가 존재한다. A5-miseq처럼 command line interface의 파이프라인이 있는가 하면, Unipro UGene처럼 GUI를 완벽하게 갖춘 통합 환경도 있다. 개별적으로 설치해야 하는 요소 프로그램이 많아지다보니 아예 이를 전부 담고 있는 리눅스 환경을 ISO 이미지로 제공하기도 한다(예: CMG-Biotools). MyPro는 아예 VirtualBox나 VMware에서 구동 가능한 가상머신 파일을 제공하고 있다.… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/n50_simple.pl?rev=1615954153&do=diff #!/usr/bin/perl # # Source: # http://genomics-array.blogspot.com/2011/02/calculating-n50-of-contig-assembly-file.html # Corrected by Haeyoung Jeong ## Read Fasta File and compute length ### # my $length; my $totalLength; my @arr; my $num; while(<>){ chomp; if(/^>([^\s]+)/){ $num++; push (@arr, $length); $totalLength += $length; $length=0; } else { s/\s//g; s/\t//g; $length += length($_); } } push (@arr, $length); # for the last contig $tota… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/n50.pl?rev=1615954153&do=diff #!/usr/bin/perl # # Source: # http://genomics-array.blogspot.com/2011/02/calculating-n50-of-contig-assembly-file.html # Modified by Haeyoung Jeong ## Read Fasta File and compute length ### # my $length; my $totalLength; my @arr; my $num; while(<>){ chomp; if(/^>([^\s]+)/){ print " $length\n" unless $num == 0; $num++; print "SEQ: $1 "; push (@arr, $length); $totalLength += $length; $length=0; } else { s/\s//g; s/\t//g; $length +=… text/html 2022-01-26T23:51:41+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/nanpore_sequencing?rev=1643241101&do=diff Nanopore sequencing * <https://community.nanoporetech.com/support/articles/how-do-i-enable-the-wifi-hotspot-on-the-mk1c> * [Nanopore community] Local basecalling * [Nanopore community] Nanopore sequencing 101 Q&As 정해영의 nanopore sequencing FAQ list 숙제: 앞으로 답을 달아 나가야 한다. MinION Mk1C * 네트워크가 도대체 잡히지 않는다. 어떻게 해야 될까? * Wi-Fi hotspot 설정만 잘 되면, 노트북 컴퓨터를 이용하여 무선으로 Mk1C 내에 ssh 진입이 가능한 것일까?… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/ncbi_submission?rev=1615954153&do=diff Data submission to NCBI and update SRA (sequence read archive) * Update guide: <https://www.ncbi.nlm.nih.gov/sra/docs/submitupdate/> text/html 2024-08-27T05:29:28+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/one-liners_for_fastq_files?rev=1724736568&do=diff One-liners for fastq files Fastq file의 앞부분에서 1만 read(40,000 라인)를 추출하기 $ head –n 40000 BL21-20x_1.fastq > small_1.fastq 또는 $ awk 'NR == 1, NR == 40000 BL21-20x_1.fastq > small_1.fastq Interleaved file을 2개의 paired file로 분리하기 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/ont_sequencing_data_analysis?rev=1615954153&do=diff Data analysis for Oxford Nanopore sequencing Oxford Nanopore Technologies(ONT)에서 제공하는 모든 공식 문서는 <http://community.nanoporetech.com/>을 참조하라(로그인 필요). PoreCamp에서도 매우 유용한 자료를 제공한다. 2016년에 영국에서 열렸던 PoreCamp의 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/p?rev=1615954153&do=diff This is a private page. text/html 2022-05-01T23:21:28+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/phylogenetic_analysis_for_dummies?rev=1651447288&do=diff Phylogenetic analysis for dummies * <http://epidemic.bio.ed.ac.uk/how_to_read_a_phylogeny> * Phylogeny.fr: Robust Phylogenetic Analysis for the non-specialist <http://phylogeny.lirmm.fr/phylo_cgi/index.cgi> * A tutorial: <https://home.ccr.cancer.gov/lco/DrawingTrees.htm> * [John Innes Centre] Introduction to Phylogenetics * [ResearchGate] How can I interpret bootstrap values on phylogenetic trees built with Maximum Likelihood method? * A practical guide to phylogenetics for nonexper… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/post_phylosift.pl?rev=1615954153&do=diff post_phylosift.pl #!/usr/bin/perl # # argument 1: phylosift output directory (PS_temp) # argument 2: marker ID (DNGNG...) if (scalar @ARGV < 2) { print STDERR "You didn's speficied enough arguments!\n"; exit; } $outdir = $ARGV[0] or 'PS_temp'; opendir OUTDIR, $outdir; @org_dir = grep { not /^\./ } readdir OUTDIR; print STDERR "Organisms detected: @org_dir"\n; closedir OUTDIR; $final = "$ARGV[1].fsa"; unlink $final if -f $final; open ALIGN, ">>$final"; foreach my $org (sort @org_dir) … text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/post-processing_of_pacbio_assemblies_using_circlator?rev=1615954153&do=diff Post-processing of PacBio assemblies using Circlator Residual error correction (preprocess) SMRT analysis의 HGAP(RS_HGAP_assembly.2 or 3)에서는 1번의 resequencing을 실행하지만 error가 남아있는 경우가 많다. 이것을 그대로 GenBank에 제출하면 pseudogene이 많다는 이유로 반송되기도 한다. 보통 전체 유전자의 10% 이상인 경우 문제가 있다고 제출자에게 되돌려 보내는 것으로 생각된다. 이런 일이 항상 벌어지는 것은 아니지만, 경험상 HGAP으로 얻은 assembly는 추가적인 교정을 하는 것이 바람직하다고 생각한다. 물론 assembly error까지를 전부 점검할 수는 없는 노릇이다. 여기서 말하는 것은 염기 수준의 에러 교정을 의미한다.… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/ppsp_output_screen?rev=1615954153&do=diff PhyloPythiaS+ test running의 출력 화면 결과물은 /mnt/apps/pps/tests/test02/에 위치한다. $ time ppsp -c /apps/pps/tools/config_ppsp_vm_refNCBI20140513_example.cfg -n -g -o s16 mg -t -p c -r -s Working contigs input fasta file created: /apps/pps/tests/test02/working/test_3strains.fna.ids Ids mapping for the working contigs fasta file created: /apps/pps/tests/test02/working/test_3strains.fna.cToIds Scaffolds -> contigs map ids file created: /apps/pps/tests/test02/working/test_3strains.fna.mapSCIds run Hidden Ma… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/pseudomonas_amygdali?rev=1615954153&do=diff Pseudomonas amygdali strains * Title: Toward complete bacterial genome sequencing through the combined use of multiple next-generation sequencing platforms * J. Microbiol. Biotechnol. 2015 Oct 14 (published online) PubMed Full text link Latest assembly results obtained through this study text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/python_installation_from_source?rev=1615954153&do=diff Python installation from source (CentOS) 파이썬을 공유 스토리지에 설치하여 여러 노드에서 같이 사용할 수 있도록 만드는 것이 이번 작업의 최종 목적이다. 그러려면 모든 노드가 갖고있는 개발 환경과 동일한 조건에서 컴파일이 이루어져야 하므로, linuxbrew가 작동하지 않도록 .bash_profile을 수정하여 로그인한 뒤 설치를 한다. text/html 2022-05-11T06:30:50+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/r_notes?rev=1652250650&do=diff 정해영의 R 노트 Private 영역에 작성한 2019 R note도 상호 보완적인 관계에 있으니 계속 업데이트해 나갈 것. 유용한 글 링크 * Advanced R by Hadley Wickham <= 강력 추천! * Simple R by Verzani * 문동선의 블로그: R언어-6.팩터와 테이블 * 5 ways to subset a data frame in R * Subsetting, extacting and bracket notation * mode와 class의 차이 * 설치된 패키지의 로드 - require()와 library()의 차이점 require()의 경우 미설치 패키지를 불러다 설치까지 한다(?)… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/r_snippets?rev=1615954153&do=diff R snippets # 리스트를 만들자! > abcde=c("a","b","c","d","e") > nato.abcde=c("Alpha","Bravo","Charlie","Delta","Echo") > myList.row = setNames(as.list(nato.abcde),abcde) > myList.col = list(alphabet = abcde, nato.phonetic.code = nato.abcde) > myList.row$a [1] "Alpha" > myList.col$alphabet[3] [1] "c" > myList.row$a [1] "Alpha" > myList.col$nato.phonetic.code[3] [1] "Charlie" > myList.row["b"] $b [1] "Bravo" > myList.col$nato.phonetic.code[which(myList.col$alphabet == "c")] [1] "Charlie" > > as.data.frame… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/r_source_code?rev=1615954153&do=diff 제37회 KOBIC 차세대 생명정보학 교육 실습용 R 코드 이 소스코드는 저자(인하대학교 유동현 교수)의 허락을 받고 공개하는 것이다. 실행환경의 customization과 설명을 위하여 약간의 수정이 이루어진 곳이 있을 수 있다. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/read_depth.pl?rev=1615954153&do=diff #!/usr/bin/perl $sum = $pos = 0; while (<>) { chomp; my @data = split /\t/, $_; if (!exists $seen{$data[0]} && $pos > 0) { print $data[0], "\t", $sum / $pos, "\n"; $sum = $pos = 0; } elsif (exists $seen{$data[0]}) { $sum += $data[2]; $pos++; } elsif (!exists $seen{$data[0]}) { print STDERR "Processing $data[0]...\n"; $seen{$data[0]} = ''; } } print "\t", $sum / $pos, "\n"; text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/reference_mapping_%EB%B0%8F_variant_calling?rev=1615954153&do=diff Reference mapping 및 variant calling 개요 * Reference로는 E. coli B str. REL606의 유전체 서열을 NCBI에서 다운로드하여 사용한다. * Short read mapper로는 bowtie2 사용(PATH 환경변수에 설정) * samtools, bctools 및 vcfutils.pl( text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/run_mummer4.sh?rev=1615954153&do=diff run-mummer4.sh #!/bin/sh # # run-mummer4.sh: MUMmer-based shell script for aligning draft sequences to a # finished genome. # if [ $# = 0 ] then echo "Usage : run-mummer4.sh <prefix> <ref_seq_file> <query_seq_file> [-q]" 1>&2 echo "The last option is for delta-filter." echo "Other nucmer default options: -maxmatch -c 100" exit 1 fi #nucmer --prefix=$1 -mum -c 100 $2 $3 nucmer --prefix=$1 -mum -c 1000 $2 $3 if [ "$4" = "-q" ] then … text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/running_phylopythias_under_ubuntu?rev=1615954153&do=diff Running PhyloPythiaS+ (PPS+ or PPSP) under Ubuntu 개요 PPSP는 metagenomic sequence에 대한 자동적인 taxonomic binning을 실시하는 도구이다. 입력물은 contig/scaffold sequence, 혹은 1 kb 이상의 long read가 전부 가능하다. 원래 expert analysis를 필요로하는 PhyloPytiaS를 개선하여 이 과정을 자동화함과 동시에 marker gene에 의한 분석이 추가된 것이다. text/html 2021-05-21T04:08:51+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/r%EC%9D%84_%ED%99%9C%EC%9A%A9%ED%95%9C_%ED%86%B5%EA%B3%84%ED%95%99_%EA%B0%9C%EB%A1%A0_2018?rev=1621570131&do=diff [KGOL] R을 활용한 통계학 개론(2018) 수강 노트 4차시: 모집단과 표본_R들어가기 'data()' 내장된 자료 파일 불러오기 > library(help=survival) 15%/%7 : integer part 15%%7: remainder part > s = seq(-5, 5, by=.2) > s = seq(length=51, from=-5, by.-2) > a = rep(x, times=5) > a = rep(x, each=5) text/html 2023-06-28T06:07:52+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/sars-cov-2_%EA%B2%80%EC%B6%9C%EC%9D%84_%EC%9C%84%ED%95%9C_pcr_%ED%94%84%EB%9D%BC%EC%9D%B4%EB%A8%B8_%EC%84%A4%EA%B3%84?rev=1687932472&do=diff SARS-CoV-2 검출을 위한 PCR 프라이머 설계 * Unordered List Item아직 위키문서 작성이 끝나지 않았습니다! --- Haeyoung Jeong 2021/12/02 08:50 * 제 블로그에 별도의 글인 감염병 진단용 PCR 프라이머 설계 그리고 결과물의 평가를 게시하였습니다. * Genes & Genomics에 제 논문이 게재되었습니다. text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/scaffolding?rev=1615954153&do=diff Mate-pair library read(Ion Torrent)를 이용한 scaffolding 개요 Mate-pair library read는 일반적으로 Illumina platform에서 생성하게 되지만, Ion Torrent에서도 생산 가능하다. (rev, for) 방향의 paired file을 만들어내는 Illumina와는 달리 Ion Torrent에서는 라이브러리 구조상 하나의 read에 di-tag이 들어있게 되므로 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/scripts_requiring_all.fna.tar.gz?rev=1615954153&do=diff Scripts requiring old all.fna.tar.gz $ grep -r "genomes/Bacteria" * Test/test_ima.ini:asmcontigs: ftp://ftp.ncbi.nih.gov/genomes/Bacteria/Candidatus_Carsonella_ruddii_uid58773/NC_008512.fna grep: Utilities/DB/kraken/taxonomy/readme.txt: 허가 거부 Utilities/cpp/Linux-x86_64/kraken/scripts/download_genomic_library.sh: wget $FTP_SERVER/genomes/Bacteria/all.fna.tar.gz Utilities/cpp/Linux-x86_64/kraken/bin/download_genomic_library.sh: wget $FTP_SERVER/genomes/Bacteria/all.fna.tar.gz Utilities/c… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/server_installation?rev=1615954153&do=diff Server installation (본 페이지는 단순히 참고를 위한 것임; 이미 실습용 서버에는 세팅이 완료되어 있으므로 수강생 여러분께서는 이를 실행할 필요가 없습니다) H/W and OS info * KT cloud, 8 core, memory 64 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/setup_a_testing_server?rev=1615954153&do=diff 실습용 서버에 프로그램 설치하기 소개의 글 이 문서는 원래 KOBIC에서 제공한 실습용 서버에 필요한 프로그램을 설치하는 방법을 설명하기 위한 것이었습니다. 따라서 /BiO 디렉토리 하위에 대부분의 프로그램(데이터도 포함)을 설치하는 것을 전제로 하였었습니다. 그러나 교육이 끝난 지금, 실습에 사용했던 환경을 여러분이 직접 사용하실 수 있는 곳에 설치하는데 도움을 주는 문서로 차차 바꾸어 나가고자 합니다. 기준 환경은 CentOS 7로 하되 Oracle VirtualBox에 설치한 가상 머신도 나쁘지는 않습니다. 이는… text/html 2024-08-27T05:10:49+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/sidebar?rev=1724735449&do=diff This is the sidebar. Without it, the main text is too wide! * Bioinformatics * K-BDS * Staff only * Upcoming topics * Introduction * Personal blog * Personal website ---------- 2019년 11월 교육 자료 * 실습용 스크립트 구글 문서라서 접속 환경에 따라 열리지 않을 수도 있습니다. * 실습용 서버에 프로그램 설치하기 * mg-GlobOS ---------- 2022년 교육 자료 text/html 2023-06-29T05:47:16+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/ssl_%EC%9D%B8%EC%A6%9D%EC%84%9C_%EB%AC%B8%EC%A0%9C%EC%9D%98_%ED%95%B4%EA%B2%B0_%EB%B0%A9%EB%B2%95?rev=1688017636&do=diff 리눅스에서 SSL 인증서 문제의 해결 방법(v0.94) * 작성자 및 최종 수정일시: --- Haeyoung Jeong 2023/06/29 14:46 * 최초 작성일: 2021년 5월 24일 * 이 문서에 대한 짧은 URL: <https://bit.ly/3hSWC9J> * How to test Internet connection on Linux 이 문서는 2년이 넘는 시행착오를 거치면서 얻은 정보를 바탕으로 다른 분들에게 도움을 드리고자 작성하였습니다. text/html 2025-05-21T04:44:26+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/start?rev=1747802666&do=diff This is an “unofficial” wiki site of Genome Informatics Laboratory at KRIBB (Korea Research Institute of Bioscience and Biotechnology). Please do not take an effort to find out what this research laboratory is about, because it is not an official (real) laboratory. This site contains pages written ether in English or in Korean. It's regrettable that pages in this site cannot be searched efficiently by Google! I don't know much about SEO (search engine optimization) text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/substitute.pl?rev=1615954153&do=diff #!/usr/bin/perl # https://stackoverflow.com/questions/12400217/replace-a-field-with-values-specified-in-another-file # answer by Vijay; later modified by Haeyoung Jeong use strict; use warnings; if ($#ARGV < 1) { print STDERR "Usage : $0 <key-value-file> <file-to-be-modified>\n"; print STDERR " First file should use tab for the field separator.\n"; exit; } my %hsh=(); open (MYFILE, $ARGV[0]); open (MYFILE2, $ARGV[1]); while (<MYFILE>) { my@arr = split/\s+/; $hsh{$arr[0]} = $… text/html 2024-02-23T06:02:39+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/system_administration?rev=1708668159&do=diff System administration tips CentOS 6.x 기준의 리눅스 시스템 관리 팁을 정리한다. 하드웨어 정보 CPU & core $ cat /proc/cpuinfo #일반 정보 $ grep "physical id" /proc/cpuinfo | sort -u | wc -l #물리적인 CPU 수 확인 $ grep "cpu cores" /proc/cpuinfo | tail -1 #CPU 당 물리적 코어 수 $ grep -c processor /proc/cpuinfo #CPU 코어 전체 수 확인 $ lscpu #display information about the CPU architecture text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/taxonimic_profiling_from_metagenome_sequences?rev=1615954153&do=diff Taxonomic profiling from metagenomic shotgun sequences (without assembly) 16S rRNA gene amplification이 아니라 whole-genome shotgun sequencing으로 얻은 metagenome read로부터 샘플 집단의 미생물 구성을 추정하고 싶다면 어떻게하는 것이 가장 적당한 방법일까? Reference mapping을 통해서 어떤 taxon에 속하는 read가 몇%라고 단순히 분류하는 것이 가장 단순해 보이지만(read classification), 여기에는 genome size에 의한 바이어스가 필연적으로 발생하게 된다. 이에 대한 설명은 metaphyler 논문에 포함된… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/test?rev=1615954153&do=diff this is a test page. text/html 2022-06-18T04:12:36+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/to_be_renamed?rev=1655525556&do=diff 제목은 나중에 정한다 이 페이지에서는 서로 관련성이 높은 다수 미생물의 미생물 유전체 시퀀싱 데이터를 가지고 수행하는 전형적인 생명정보학적 분석 방법을 다루고자 한다. 관련성이 높다 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/transcriptome_analysis?rev=1615954153&do=diff RNA-seq-based bacterial transcriptome analysis RNA-seq을 이용한 진핵 생물의 전사체(transcriptome) 분석에서는 TopHat-Cufflioks-Cuffmerge-Cuffdiff-(CummeRbund)로 이어지는 Tuxedo protocol이 표준으로 여겨지고 있다. 여기에서는 splicing을 고려한 read alignment, 새로운 유전자의 발견, novel splice variant의 발견 등이 관건이 된다. Cufflinks version 2.2.0부터는 Cuffquant/Cuffnorm이라는 새로운 프로그램을 포함하는 워크플로우로 바뀌었다(… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/two_bt_strains_2016?rev=1615954153&do=diff Bacillus thuringiensis serovar kurstaki BP865 (=KCTC 8689P) and serovar aizawai HD-133 * Title: Genome sequences of Bacillus thuringiensis serovar kurstaki strain BP865 and B. thuringiensis serovar aizawai strain HD-133. Genome Announcements (2017) 5 e01544-16. ANI analysis (pyani) Placement of contigs into putative plasmids text/html 2025-01-20T00:44:58+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/unclassified?rev=1737333898&do=diff Unclassified topics trimAl * 논문 PubMed * <http://trimal.cgenomics.org/> * <http://trimal.cgenomics.org/getting_started_with_trimal_v1.2> [BioStars] Removing gapped columns from a multiple sequence alignment trimal -in test -out test_nogaps_trimal -nogaps Uses a heuristic method to decide which is the best automated method to trim the input alignment. trimal -in <inputfile> -out <outputfile> -automated1 text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/upcoming_topics?rev=1615954153&do=diff Upcoming topics * GNU Parallel * Blast2GO pro * Open Grid Engine * Oxford Nanopre sequencing * Epidemiology text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/whole-genome_alignment?rev=1615954153&do=diff Whole-genome alignment (MUMmer) MUMmer는 suffix tree algorithm을 이용하여 genome sequence 수준의 alignment를 생성하는 도구이다. 발표된지는 매우 오래되었으나 매우 완성도가 높아서 여전히 많은 프로그램에서 활용되고 있다. 기본 컨셉트는 20 nt의 짧은 exact match(-l 옵션으로 조정 가능)을 reference와 query genome 모두에서 찾아내는 것이다. MUMmer는 alignment를 시각화하는 도구는 탑재하고 있지 않으므로… text/html 2021-03-17T04:09:13+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/working_with_metadata_table_clc?rev=1615954153&do=diff Working with metadata table (CLC Genomics Workbench) 최근 CLC Genomics Workbench에서 새롭게 도입하여 발전시킨 개념은 바로 track과 metadata table 활용 기능이 아닐까 한다. Track은 대용량의 NGS data를 위한 시각화와 비교 및 분석을 용이하게 만드는 통일 프레임워크인데, 글로는 그 개념을 뚜렷이 드러나게 설명하기가 어렵다. 이 페이지에서 다룰 사항은 바로 메타데이터이다. 이는 '데이터를 기술하는 데이터'라고 간단하게 정의할 수 있다. 예를 들어 하나의 RNA-seq sequencing file이 얻어진 경우 이것이 유래한 샘플의 성격, 처리 정보, 샘플의 원천 등 다양한 부가 정보를 엑셀 파일이나 csv(comma-separated values) file로 작성할 수 있다. CLC Genomics Workbench에서는 임포트 기능을 이용하여 이미 만들어진 메타데이터 파일을 읽어들이거나, 혹은 직접… text/html 2022-06-27T03:39:54+00:00 Anonymous (anonymous@undisclosed.example.com) https://www.genoglobe.com/kribb/%EB%8B%A8%EC%9D%BC_contig_%EC%84%9C%EC%97%B4%EC%9D%98_%ED%9B%84%EC%B2%98%EB%A6%AC?rev=1656301194&do=diff 단일 contig 서열의 후처리 개요 Sanger sequencing 방법이 주류를 이루던 과거에는 복잡한 finishing 과정을 거쳐서 실제 염색체에 해당하는 단일 염기서열을 최종적으로 만들어내야 했지만 요즘은 PacBio sequencing을 통해서 단번에 단일 contig 서열을 얻게 되었다. 세균의 유전체는 원칙적으로 원형 구조를 이루고 있으므로, genome project를 통해 완성된 단일 서열은 양 끝에 겹치는 서열이 존재하게 된다. 이를 제거하는 일과 더불어서 putative replication origin(…